Amplified loci, primers, polymerase chain reaction (PCR) conditions, and references for the molecular characterization of Apignomonia platani and Diaporthe eres isolates from this study. Apn2 (DNA-[apurinic or apyrimidinic site] lyase); TUB (β-tubulin); EF1-α (elongation factor); ITS (internal transcribed spacer); CAL (calmodulin).
Locus | Primers | PCR conditions | Product size (base pairs) | References |
---|---|---|---|---|
Apn2 | apn2fw2: GCMATGTTYGAMATYCTGGAG apn2rw2: CTTGGTCTCCCAGCAGGTGAAC | 95 °C 1 min; (95 °C 30 s, 54 °C 30 s, 72 °C 1 min) × 40 cycles; 72 °C 10 min | 700 | Adapted from Udayanga et al. 2014 |
TUB | Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC | 94 °C 2 min; (94 °C 30 s, 55 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min | 450 | Adapted from Glass et al. 1995 |
EF1-α | EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC | 95 °C 1 min; (94 °C 30 s, 58 °C 50 s, 72 °C 1 min) × 35 cycles; 72 °C 10 min | 350 | Adapted from Carbone and Kohn 1999 |
ITS | ITS4: TCCTCCGCTTATTGATATGC ITS5: GGAAGTAAAAGTCGTAACAAGG | 94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min | 500 | Adapted from White et al. 1990 |
CAL | CAL-228F: GAGTTCAAGGAGGCCTTCTCCC CAL-737R: CATCTTTCTGGCCATCATGG | 94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 35 cycles; 72 °C 3 min | 500 | Adapted from Carbone and Kohn 1999 |