Article Figures & Data
Figures
- Figure 1.
Examples of necrotic lesions observed on leaves of Platanus occidentalis ‘Davis’ and wildtype.
- Figure 2.
Examples of dieback symptoms observed on Platanus occidentalis wildtype (left) and ‘Davis’ (right).
- Figure 3.
Average lesion lengths on wildtype and ‘Davis’ sycamore plants inoculated with Diaporthe eres. The 2 means are significantly different by one-tailed t-test.
Tables
- Table 1.
Amplified loci, primers, polymerase chain reaction (PCR) conditions, and references for the molecular characterization of Apignomonia platani and Diaporthe eres isolates from this study. Apn2 (DNA-[apurinic or apyrimidinic site] lyase); TUB (β-tubulin); EF1-α (elongation factor); ITS (internal transcribed spacer); CAL (calmodulin).
Locus Primers PCR conditions Product size (base pairs) References Apn2 apn2fw2:
GCMATGTTYGAMATYCTGGAG
apn2rw2:
CTTGGTCTCCCAGCAGGTGAAC95 °C 1 min; (95 °C 30 s, 54 °C 30 s, 72 °C 1 min) × 40 cycles; 72 °C 10 min 700 Adapted from Udayanga et al. 2014 TUB Bt2a:
GGTAACCAAATCGGTGCTGCTTTC
Bt2b:
ACCCTCAGTGTAGTGACCCTTGGC94 °C 2 min; (94 °C 30 s, 55 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min 450 Adapted from Glass et al. 1995 EF1-α EF1-728F:
CATCGAGAAGTTCGAGAAGG
EF1-986R:
TACTTGAAGGAACCCTTACC95 °C 1 min; (94 °C 30 s, 58 °C 50 s, 72 °C 1 min) × 35 cycles; 72 °C 10 min 350 Adapted from Carbone and Kohn 1999 ITS ITS4:
TCCTCCGCTTATTGATATGC
ITS5:
GGAAGTAAAAGTCGTAACAAGG94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 40 cycles; 72 °C 3 min 500 Adapted from White et al. 1990 CAL CAL-228F:
GAGTTCAAGGAGGCCTTCTCCC
CAL-737R:
CATCTTTCTGGCCATCATGG94 °C 2 min; (94 °C 30 s, 58 °C 1 min, 72 °C 1 min) × 35 cycles; 72 °C 3 min 500 Adapted from Carbone and Kohn 1999 - Table 2.
Measurements of incidence and severity of leaf necrosis (recorded in 2018 and 2019) that were used to compare sycamore (Platanus occidentalis) wildtype and ‘Davis’ trees.
Year P. occidentalis Leaf necrosis Incidence (range %)x Mean rAUDPCy of incidencez P-value Severity (range %)x Mean rAUDPCy of severityz P-value 2018 wildtype 22-54 15.19 a 0.99 3-17 1.99 a 0.047 ‘Davis’ 16-93 15.14 a 2-8 1.24 b 2019 wildtype 16-100 16.14 B < 0.001 20-32 0.41 A 0.44 ‘Davis’ 38-81 38.81 A 6-44 0.5 A ↵x Range of disease incidence and severity values were recorded at the end of the trial in August of each year.
↵y rAUDPC = relative area under the disease progress curve. Columns represent the AUDPC values divided by the total number of days between the first and the last assessment.
↵z Columns not connected by the same letter are statistically different according to Tukey Honest Significant Difference test (a = 0.05).
- Table 3.
Measurements of incidence of dieback (recorded in 2019) that were used to compare sycamore (Platanus occidentalis) wildtype and ‘Davis’ trees.
P. occidentalis Dieback Incidence (range %)x Mean rAUDPCy of incidencez P-value wildtype 32-100 66.33 a 0.001 ‘Davis’ 5-47 19.75 b ↵x Range of disease incidence values were recorded at the end of the trial in August 2019.
↵y rAUDPC = relative area under the disease progress curve. Columns represent the AUDPC values divided by the total number of days between the first and the last assessment.
↵z Columns not connected by the same letter are statistically different according to Tukey Honest Significant Difference test (a = 0.05).
Jump to section
Related Articles
Cited By...
- No citing articles found.